View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_51 (Length: 307)
Name: NF18003_low_51
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 11 - 274
Target Start/End: Complemental strand, 40549331 - 40549069
Alignment:
| Q |
11 |
caaaggtgctgctttcttgtatgaaaagtttgtgagaccacacgttcgaaaatacatcacacctaagaaggtgagttagggaattttttgttttattaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40549331 |
caaaggtgctgctttcttgtatgaaaagtttgtgagaccacacgttcgaaaatacatcacacctaagaaggtgagttagggaattttt-gttttattaaa |
40549233 |
T |
|
| Q |
111 |
tttcttttgatgatttaaatgattcaatttctgatacgattagtcatggtgttatgatggtgaataggtgtaaaacgattcatgaggcatactgaaaagg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549232 |
tttcttttgatgatttaaatgattcaatttctgatacgattagtcatggtgttatgatggtgaataggtgtaaaacgattcatgaggcatactgaaaagg |
40549133 |
T |
|
| Q |
211 |
aagaagaaggatggtgctgctgagtaggatgactttaagctttggaccaaagattgaattcgtt |
274 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549132 |
aagaagaaggatggtgctgctgagcaggatgactttaagctttggaccaaagattgaattcgtt |
40549069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University