View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_55 (Length: 293)
Name: NF18003_low_55
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 20 - 288
Target Start/End: Complemental strand, 33135483 - 33135215
Alignment:
| Q |
20 |
aggccgccgttggagtataaacctccaccggagaaacggaaatgtcctccgttaacaggtgtttgtttattgtttttgttaggtctacatgatcatttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33135483 |
aggccgccgttggagtataaacctccaccggagaaacgaaaatgtcctccgttaacaggtgtttgattattgtttttgttaggtctacatgatcatttgt |
33135384 |
T |
|
| Q |
120 |
tgtgaattgatgttaattatagttaattatgcaattaatccttcgttttatgnnnnnnngtttagggatggcgcaatttgtgagcaaatttgctgaacct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33135383 |
tgtgaattgatgttaattatagttaattatgcaattaatccttcgttttatgtttttttgtttagggatggcgcaatttgtgagcaaatttgctgaacct |
33135284 |
T |
|
| Q |
220 |
ggtgaaccggaatattctccgcctgtgccagtagttgaaactcctgtaatgttctgttcctttgctact |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
33135283 |
ggtgaaccggaatattctccgcctgtgccagtagttgaaactcctgtaatgttctgttcttttgatact |
33135215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University