View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_68 (Length: 250)
Name: NF18003_low_68
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 70 - 239
Target Start/End: Original strand, 9630675 - 9630844
Alignment:
| Q |
70 |
cttagtgggcttcaggtcctgcgctcgaatccagtcttgggaatgcagcaacgttaaaacttttcttagtcttttctaatgaatttttggttggtaaatc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9630675 |
cttagtgggcttcaggtcctgcgctcgaatccagtcttgggaatgcaacaacgttaaaacttttcttagtcttttctaatgaatttttggttggtaaatc |
9630774 |
T |
 |
| Q |
170 |
tgttatgtaaataaacttggttgttaaacatttttcaactgaagttgaatatttatgatgatttgttctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9630775 |
tgttatgtaaataaacttggttgttaaacatttttcaactgaaattgaatatttatgatgatttgttctt |
9630844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 38743779 - 38743816
Alignment:
| Q |
96 |
gaatccagtcttgggaatgcagcaacgttaaaactttt |
133 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
38743779 |
gaatctagtcttgggcatgcagcaacgttaaaactttt |
38743816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 9679529 - 9679473
Alignment:
| Q |
19 |
agtagccaca-gtggaccttatgtgccaaaagacactgccgatatttgtgctcttag |
74 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9679529 |
agtagccacacgtggaccttatgtgccaaaagacactgccgatatttgtgctcttag |
9679473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 17312693 - 17312637
Alignment:
| Q |
19 |
agtagccaca-gtggaccttatgtgccaaaagacactgccgatatttgtgctcttag |
74 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17312693 |
agtagccacacgtggaccttatgtgccaaaagacactgccgatatttgtgctcttag |
17312637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 9268578 - 9268633
Alignment:
| Q |
19 |
agtagccaca-gtggaccttatgtgccaaaagacactgccgatatttgtgctctta |
73 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9268578 |
agtagccacacgtggaccttatgtgccaaaagacactgccgatatttgtgctctta |
9268633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 2680948 - 2680895
Alignment:
| Q |
19 |
agtagccaca-gtggaccttatgtgccaaaagacactgccgatatttgtgctct |
71 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2680948 |
agtagccacacgtggaccttatgtgccaaaagacactgtcgatatttgtgctct |
2680895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 127
Target Start/End: Complemental strand, 9066153 - 9066120
Alignment:
| Q |
94 |
tcgaatccagtcttgggaatgcagcaacgttaaa |
127 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
9066153 |
tcgaatccagtcttgggtatgcagcaacgttaaa |
9066120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 130
Target Start/End: Complemental strand, 7242909 - 7242873
Alignment:
| Q |
94 |
tcgaatccagtcttgggaatgcagcaacgttaaaact |
130 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7242909 |
tcgaatccagtcttggacatgcagcaacgttaaaact |
7242873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University