View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18003_low_69 (Length: 249)

Name: NF18003_low_69
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18003_low_69
NF18003_low_69
[»] chr2 (1 HSPs)
chr2 (1-140)||(9590159-9590298)


Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 9590159 - 9590298
Alignment:
1 catgtcacctattgctgcttgcaaatcagtatggttaaaaggatgtatagtagtagattgtgattgtgcgaatccaaggagaaaaagaatcataaacaaa 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||    
9590159 catgtcacctattgctgcttgtaaatcagtatggttaaaaggatgtatagtagtagattgtgattgtgcaaatccaaggagaaaaagaaacataaacaaa 9590258  T
101 tattgtagacccattttggagaaaagggaagaaaagaaat 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
9590259 tattgtagacccattttggagaaaagggaagaaaagaaat 9590298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University