View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_70 (Length: 248)
Name: NF18003_low_70
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 121 - 229
Target Start/End: Complemental strand, 20385526 - 20385418
Alignment:
| Q |
121 |
gaaaaatagaattgaattcggaattcaatagaaagtacggttcaaaactataatgcaaattacggttgctaggtttctgaaattctaaaagtggacggtg |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20385526 |
gaaaactagaattgaattcggaattcaatagaaagtacggttcaaaactataatgcaaattacggttgctaggtttctgaaattctaaaagtggacggtg |
20385427 |
T |
|
| Q |
221 |
gctagggtt |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
20385426 |
gctagggtt |
20385418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 85 - 124
Target Start/End: Complemental strand, 20385605 - 20385566
Alignment:
| Q |
85 |
tggaattggaatacggcaatcacagagttgacatgtgaaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20385605 |
tggaattggaatacggcaatcacagagttgacatgtgaaa |
20385566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University