View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_74 (Length: 235)
Name: NF18003_low_74
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_74 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 32789350 - 32789140
Alignment:
| Q |
1 |
caataaatttaagagctagctcttaaaggaagaattgtgatgaggagataatggatgcttttgatcttaagaatatagaatatgtctatatgtatggaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789350 |
caataaatttaagagctagctcttaaaggaagaattgtgatgaggagataatggatggttttgatcttaagaatatagaatatgtctatatgtatggaaa |
32789251 |
T |
 |
| Q |
101 |
atttggatatgtgagttttctaaagggttaatttgcttcaataaattgagattgagagttggaagtttggacatgcaaaatgaaagaggaagggagaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32789250 |
atttggatatgtgagttttctaaagggttaatttgcttcaataaattgagattgagagttggaagtttggatatgcaaaatgaaagaggaagggagaagt |
32789151 |
T |
 |
| Q |
201 |
aagaagtaaga |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
32789150 |
aagaagtaaga |
32789140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University