View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_75 (Length: 234)
Name: NF18003_low_75
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 30652101 - 30652268
Alignment:
| Q |
1 |
cttgttatgagttattatgagtttataagttattttgtcattgtacacatgaattattacaagtttattagttatttcaacactaaaagtttatgcgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
30652101 |
cttgttatgagttattatgagtttataagttattttttcattgtacacatgaattattacaagtttattaattatttcaacactaaaagtttatgtcaaa |
30652200 |
T |
 |
| Q |
101 |
gtcatattcctaagttttttagttttg-ttccctttgtcgatgatttatgttaatatcatgttgatga |
167 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30652201 |
gtcatattcctaagttttttagttttgtttccctttgtcgatgatttatgttagtatcatgttgatga |
30652268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 46632274 - 46632143
Alignment:
| Q |
1 |
cttgttatgagttattatgagtttataagttattttgtcattgtacacatgaattattacaagtttattagttatttcaacactaaaagtttatgcgaaa |
100 |
Q |
| |
|
||||| |||||||||||||| ||||||| ||| |||| ||||||||||||||||||||| ||||||| || ||| ||||||||| ||||||| ||| |
|
|
| T |
46632274 |
cttgtcatgagttattatgattttataacttactttggcattgtacacatgaattattatgagtttatgag-tat----acactaaaattttatgcaaaa |
46632180 |
T |
 |
| Q |
101 |
gtcatattcctaagttttttagttttgttccctttgt |
137 |
Q |
| |
|
|||| || |||||||||| |||||||||||||||| |
|
|
| T |
46632179 |
ttcatctttataagttttttcgttttgttccctttgt |
46632143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University