View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_79 (Length: 213)
Name: NF18003_low_79
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_79 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 72 - 196
Target Start/End: Original strand, 43224465 - 43224589
Alignment:
| Q |
72 |
tatcgaaaggggtttctttttatttggtacacaatgatttgggtgttttggaatgtgagaaatgataggattttcaacagtagaattgtgaccatcaatg |
171 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43224465 |
tatcgaaaggggtttctttttatttggcacacaatgatttgggtgttttggaatgtgagaaatgataggattttcaactgtagaattgtgaccatcaatg |
43224564 |
T |
 |
| Q |
172 |
agaattttggggatatcaaggttat |
196 |
Q |
| |
|
| | ||||||||||||||||||||| |
|
|
| T |
43224565 |
aaatttttggggatatcaaggttat |
43224589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University