View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_84 (Length: 201)
Name: NF18003_low_84
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_84 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 92 - 201
Target Start/End: Original strand, 38735676 - 38735786
Alignment:
| Q |
92 |
taaatataaaaacatttt-taaatcttctatcttgaattttcagaatcattgcaaaagctgaacgggtaagataagaccaagagagaaatagacattcta |
190 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38735676 |
taaatataaaaacattttttaaatcttatatcttgaattttcagaatcattgcaaaagcagaacgggtaagataagaccaagagagaaatagacattcta |
38735775 |
T |
|
| Q |
191 |
acacagaacat |
201 |
Q |
| |
|
||||||||||| |
|
|
| T |
38735776 |
acacagaacat |
38735786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 76
Target Start/End: Complemental strand, 17661914 - 17661865
Alignment:
| Q |
29 |
agcgaatacaggaccaatttttaaacg--cccaaattgcaaggattaaat |
76 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||| |||| |
|
|
| T |
17661914 |
agcgaatacaggaccaatttttaaacgacccctaattgcaaggatgaaat |
17661865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University