View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18004_high_9 (Length: 236)
Name: NF18004_high_9
Description: NF18004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18004_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 56 - 218
Target Start/End: Original strand, 44627313 - 44627475
Alignment:
| Q |
56 |
tatgaaacctggtgagaacatagacgatatgcaaatgcggttttatgatcttgttaaccatcttgcttcattggggaaaaggattcctaatgtaggtaga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44627313 |
tatgaaacctggtgagaacatagacgatatgcaaatgcggttttatgatcttgttaaccatcttgcttcattggggaaaaggattcctaatgtaggtaga |
44627412 |
T |
 |
| Q |
156 |
cttggtctacaaagttttgagaagtttgagtaggaaatggcagcacaaggtcagaactataat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44627413 |
cttggtctacaaagttttgagaagtttgagtaggaaatggcagcacaaggtcagaactataat |
44627475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 56 - 217
Target Start/End: Original strand, 26080549 - 26080706
Alignment:
| Q |
56 |
tatgaaacctggtgagaacatagacgatatgcaaatgcggttttatgatcttgttaaccatcttgcttcattggggaaaaggattcctaatgtaggtaga |
155 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||| ||||||| ||||||||||| ||||| |||| |||||||||| | ||| |
|
|
| T |
26080549 |
tatgaaacctggtgagaacatacatgatatgcaaatgcggttttatgatgttgttaatcatcttgcttcgttgggtaaaaagattcctaat----gaaga |
26080644 |
T |
 |
| Q |
156 |
cttggtctacaaagttttgagaagtttgagtaggaaatggcagcacaaggtcagaactataa |
217 |
Q |
| |
|
||||| ||||||||||||| ||||||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
26080645 |
tttggttagcaaagttttgagatgtttgagtaagaaatggcggcacaaggtcagagctataa |
26080706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University