View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18004_low_11 (Length: 230)
Name: NF18004_low_11
Description: NF18004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18004_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 33698422 - 33698226
Alignment:
| Q |
1 |
ccaacacaaatcttgcagcctcaggacttgttaacatcacacatggacatcctaatatgtgtgtcttaaatatttctccatatctgattatgatcacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33698422 |
ccaacacaaatcttgcagcctcaggacttgttaacatcacacatggacatcctaatatgtgtgtcttaaatatttctccatatctgatt----------- |
33698334 |
T |
|
| Q |
101 |
tgtaagattataattaagttagtacatccaaaaaacataataaagcttaccaaatttatatatataattaaggaaaagataaagaaccttttttgcttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33698333 |
--------tataattaagttagtacatccaaaaaacataataaagcttaccaaatttatatatataattaaggaaaagataaagaaccttttttgcttag |
33698242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 33657887 - 33657794
Alignment:
| Q |
1 |
ccaacacaaatcttgcagcctcaggacttgttaacatcacacatggacatcctaatatgtgtgtcttaaatatttctccatatctgattatgat |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||| ||||||||| |||| |||| ||||| || |||||||| ||||| ||||| |
|
|
| T |
33657887 |
ccaacacaaatcttgcagcctcaggacttgctagcatcacacattgacatcctagtatgcgtgttttaaaaatctctccatacctgatcatgat |
33657794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 13909863 - 13909799
Alignment:
| Q |
18 |
gcctcaggacttgttaacatcacacatggacatcctaatatgtgtgtcttaaatatttctccata |
82 |
Q |
| |
|
||||||||||||| || ||||||||| ||||| |||| |||||||||||| ||||| |||||||| |
|
|
| T |
13909863 |
gcctcaggacttgatatcatcacacaaggacaacctagtatgtgtgtcttgaatatatctccata |
13909799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University