View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18005_low_6 (Length: 326)
Name: NF18005_low_6
Description: NF18005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18005_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 129 - 318
Target Start/End: Original strand, 44798760 - 44798949
Alignment:
| Q |
129 |
cgatggcattgcttttctcatttcatcaaccactgatttctcgtctctctctaatggttacatgggccttcctcattctgatcaagattcttactttgcg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798760 |
cgatggcattgcttttctcatttcatcaaccactgatttctcgtctctctctaatggttacatgggccttcctcattctgatcaagattcttactttgcg |
44798859 |
T |
|
| Q |
229 |
gttgaatttgatacaagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttcctttgct |
318 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44798860 |
gttgaatttgatacgagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttcttttgct |
44798949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 44798632 - 44798698
Alignment:
| Q |
1 |
tctggaattggaagagctttctacctctatcctgttcgttttcttgatcctttaactaactcaaccg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798632 |
tctggaattggaagagctttctacctctatcctgttcgttttcttgatcctttaactaactcaaccg |
44798698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University