View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18006_low_23 (Length: 339)
Name: NF18006_low_23
Description: NF18006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18006_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 16 - 106
Target Start/End: Complemental strand, 13890417 - 13890326
Alignment:
| Q |
16 |
atgggttcatcattgtcattgtgtgtaagttg-ttgactgttgtgtttacttaattacagtgccaatagccgaatttataacatattgtaac |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13890417 |
atgggttcattattgtcattgtgtgtaagttgattgattgttgtgtttacttaattacagtgccaatagccgaatttataacatattgtaac |
13890326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 62 - 102
Target Start/End: Original strand, 14000628 - 14000668
Alignment:
| Q |
62 |
tacttaattacagtgccaatagccgaatttataacatattg |
102 |
Q |
| |
|
|||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
14000628 |
tacttaatcagattgccaatagccgaatttataacatattg |
14000668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University