View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18006_low_27 (Length: 302)
Name: NF18006_low_27
Description: NF18006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18006_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 279
Target Start/End: Complemental strand, 28133445 - 28133185
Alignment:
| Q |
19 |
ggttctggttcgggttctagggtttctgaggatgggagaaggaatggtagggatagagattcgagtcgggattcggggccgtccagggctgatgaaattg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28133445 |
ggttctggttcgggttctagggtttctgaggatgggagaaggaatggtagggatagagattcgagtcgggattcggggccgtcgagggctgatgaaattg |
28133346 |
T |
 |
| Q |
119 |
ataattgggctgctgggaagaaggctgttgttgggaatgggtttgagagaagggagagaggtggaggtggaggtgggttttttgattctcagtcgcgggc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28133345 |
ataattgggctgctgggaagaaggctgttgttgggaatgggtttgagagaagggagagaggtggaggtggaggtgggttttttgattctcagtcgcgggc |
28133246 |
T |
 |
| Q |
219 |
tgatggatcagatagttgggtttcgggtaaggtgccatcggagggacggagatttggttcc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28133245 |
tgatggatcagatagttgggtttcgggtaaggtgccatcggagggacggagatttggttcc |
28133185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University