View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18006_low_35 (Length: 258)
Name: NF18006_low_35
Description: NF18006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18006_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 2 - 243
Target Start/End: Complemental strand, 16017480 - 16017239
Alignment:
| Q |
2 |
tgaatctaacacgtttgaaaattttgctgccatcagctattactatggctgtgatataaacaccgcgttcaaattgttcaatgaccgatgtttctccttc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16017480 |
tgaatctaacacgtttgaaaattttgctgccatcagctattactatggctgtgatataaacaccgcgttcaaattgttcaatgaccgatgtttctccttc |
16017381 |
T |
|
| Q |
102 |
tctcacaggcctggacgactcctgtgatctgatactattttccgagtttggtggagagactgcattagttgataaatacgagctgctactgctttcttga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16017380 |
tctcacaggcctggacgactcctgtgatctgatactattttccgagtttggtggagagactgcattagttgataaatacgagctgctactgctttcttga |
16017281 |
T |
|
| Q |
202 |
cgatcatctcctccatttgttgatcgaacaacctcagaaact |
243 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16017280 |
cgatcatctgctccatttgttgatcgaacaacctcagaaact |
16017239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University