View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18006_low_7 (Length: 503)

Name: NF18006_low_7
Description: NF18006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18006_low_7
NF18006_low_7
[»] chr4 (2 HSPs)
chr4 (9-83)||(12884272-12884346)
chr4 (119-205)||(12884447-12884533)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 6e-32; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 9 - 83
Target Start/End: Original strand, 12884272 - 12884346
Alignment:
9 gaagaatattgtgttgctggaggaacctgcgggtgggaattggttcaatatgaaggttgttatgggggtagtaaa 83  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
12884272 gaagaatattgtgttgctggaggaacctgcgggtgggaattggttcaatatgaaggttgttatgagggtagtaaa 12884346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 119 - 205
Target Start/End: Original strand, 12884447 - 12884533
Alignment:
119 tgggtgggtgataaccctcttcgtgttaggttccctagaatgaattcactttcaaaccaaaaggaaggcttctttaacgaaatggaa 205  Q
    ||||||||||||||||||||||||||||||||||||  |||  ||||||||||| |||||||| ||||| || ||||||||||||||    
12884447 tgggtgggtgataaccctcttcgtgttaggttccctcaaatttattcactttcagaccaaaagaaaggcctcattaacgaaatggaa 12884533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University