View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_high_37 (Length: 364)
Name: NF18007_high_37
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_high_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 13 - 239
Target Start/End: Complemental strand, 3222633 - 3222407
Alignment:
| Q |
13 |
aaaatatttaaggcattgagaatatatgtcactgttattatatatatgcaacattaaaatgattcatagtcgatatgagattattattcagaattgatta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3222633 |
aaaatatttaaggcattgagaatatatgtcattgttattatatataaacaatattaaaatgattcatagtcgatatgagattattattcagagttgatta |
3222534 |
T |
|
| Q |
113 |
atatcaacaatatctctctcaaatgtgtgaatattccacatcactatacttagtcccaacactaggactctgctcctctactaggagcaacaataaagca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3222533 |
atatcaacaatatctctctcaaatgtgtgaatattccacatcactatacttaatcctaacactaggactctgctcctctactaggagcaacaatagagca |
3222434 |
T |
|
| Q |
213 |
atgatggtggaccaccatcaaagatta |
239 |
Q |
| |
|
||||| |||||||||||| ||| |||| |
|
|
| T |
3222433 |
atgatcgtggaccaccataaaaaatta |
3222407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 280 - 346
Target Start/End: Complemental strand, 3222404 - 3222338
Alignment:
| Q |
280 |
tataccttgagtttgtgatttggatattgctttgcaccttttctctttattctccttagcaacaaac |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3222404 |
tataccttgagtttgtgatttggatattgctttgcaccttttctctttattctccttaggaacaaac |
3222338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University