View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_high_63 (Length: 262)
Name: NF18007_high_63
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_high_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 9 - 164
Target Start/End: Complemental strand, 3038747 - 3038592
Alignment:
| Q |
9 |
gatatgaaatagtgaaggattttgtacaggttatcaactattatttctacactttggggctacatgtggcagtgcccagtacaagtcctcctaggaagga |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3038747 |
gataagaaatagtgaaggattttgtacaggttatcaactattatttctacactttggggctacatgtggcagtgcccagtacaagtcctcctaggaagga |
3038648 |
T |
|
| Q |
109 |
aatttctctcaataagatgacgatagatgtataatgaggatgatgtaaatttagag |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3038647 |
aatttctctcaataagatgacgatagatgtataatgaggatgatgtaaatttagag |
3038592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University