View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18007_high_65 (Length: 260)

Name: NF18007_high_65
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18007_high_65
NF18007_high_65
[»] chr2 (1 HSPs)
chr2 (14-244)||(11346704-11346935)


Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 14 - 244
Target Start/End: Complemental strand, 11346935 - 11346704
Alignment:
14 gaaggtaaaacgttttcaaac-gaataacggcttggaaatttgttctgccgagttcaatgaactttgcaaggaagaacacattacaaggcaatatacggt 112  Q
    ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11346935 gaaggtaaaacgtcttcaaactgaataacggcttggaaatttgttctgccgagttcaatgaactttgcaaggaagaacacattacaaggcaatatacggt 11346836  T
113 gagaaatactccacaaaagaatggtgttgctgagcgaatgaatataactttttggaaagagctcgttgtatgttttcaaatgccaggctgaataggagtt 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
11346835 gagaaatactccacaaaagaatggtgttgctgagcgaatgaatataactttttggaaagagctcgttgtatgttttcaaatgccgggctgaataggagtt 11346736  T
213 tccaagcagaggctataagcacaaaatgttat 244  Q
    ||||||||||||||||||||||||||||||||    
11346735 tccaagcagaggctataagcacaaaatgttat 11346704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University