View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_high_90 (Length: 219)
Name: NF18007_high_90
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_high_90 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 15508818 - 15508629
Alignment:
| Q |
14 |
aatatcaagaacatgtaagagttaacaaaattcaaatccactcatttgactaaaacaaggaaagcataaaaggaaggaaaatgaggatggcagcagaata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15508818 |
aatatcaagaacatgtaagagttaacaaaattcaaatccactcatttgactaaaaaaaggaaagcataaaaggaaggaaaatgaggatggcagcagaata |
15508719 |
T |
|
| Q |
114 |
agtgagggttggtagagaagcagatgattttggtgttggtgcaggagccattaccattcctggcatatcgttagacactttgatatttat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15508718 |
agtgagggttggtagagaagcagatgattttggtgttggtgcaggagccattaccattcctggcatatcgttagacactttgatatttat |
15508629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University