View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18007_high_95 (Length: 205)

Name: NF18007_high_95
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18007_high_95
NF18007_high_95
[»] chr3 (2 HSPs)
chr3 (15-87)||(29185909-29185982)
chr3 (150-186)||(29186045-29186081)


Alignment Details
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 15 - 87
Target Start/End: Original strand, 29185909 - 29185982
Alignment:
15 gatgaaataagagaccaaaagaatgtaattaa-ttgagatgaagtgttctttacaaaataattagggaaatttg 87  Q
    |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||    
29185909 gatgaaataagagaccaaaagaatgtaactaaattgagatgaagtgttctttacaaagtaattagggaaatttg 29185982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 150 - 186
Target Start/End: Original strand, 29186045 - 29186081
Alignment:
150 gataataacatatactacaaacttggcaatttcaccc 186  Q
    |||||||||||||||||||||||||||||||||||||    
29186045 gataataacatatactacaaacttggcaatttcaccc 29186081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University