View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_low_105 (Length: 201)
Name: NF18007_low_105
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_low_105 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 156
Target Start/End: Original strand, 40595434 - 40595575
Alignment:
| Q |
15 |
aatatgcaaagatataatttgtttcctcatgctctctagagagtgatacataaccaatttatttatctttgcaacttaaccttgtcagaaattaaaactt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595434 |
aatatgcaaagatataatttgtttcctcatgctctctagagagtgatacataaccaatttatttatctttgcaacttaaccttgtcagaaattaaaactt |
40595533 |
T |
 |
| Q |
115 |
gctactttttgcagtgcacacaacagcataaaggcatttggc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595534 |
gctactttttgcagtgcacacaacagcataaaggcatttggc |
40595575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University