View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_low_55 (Length: 305)
Name: NF18007_low_55
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 289
Target Start/End: Original strand, 28609487 - 28609747
Alignment:
| Q |
15 |
aaaggtgggaaaggaagaaaaaggggcataaatgattatggcccgaaaagnnnnnnngaacgacccaattatgagagaaagagattggtcagcaaaaata |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609487 |
aaaggtgggaaaggaagaaaaagaggcataaatgattatagcccgaaaagaaaaaaagaacgacccaattatgagagaaagagattggtcagcaaaaata |
28609586 |
T |
|
| Q |
115 |
atataatttgattagtgtcttgttgcccatatagtttgttctacctgatgtagcatggagtagctgcttgaatgaaaattgcacatgctgtgtttagcca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609587 |
atataatttgattagtgtcttgttgcccatatagtttgttctacctgatgtagcatggagtagctgcttgaatgaaaattgcacatgctgtgtttagcca |
28609686 |
T |
|
| Q |
215 |
ttggcatatcaataaatctagatgtagatcatccattttcacactttatatatttatacatttaggtttctatat |
289 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609687 |
ttggcatatcaataaat--------------tccattttcacactttatatatttatacatttaggtttctatat |
28609747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University