View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_low_71 (Length: 260)
Name: NF18007_low_71
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 14 - 244
Target Start/End: Complemental strand, 11346935 - 11346704
Alignment:
| Q |
14 |
gaaggtaaaacgttttcaaac-gaataacggcttggaaatttgttctgccgagttcaatgaactttgcaaggaagaacacattacaaggcaatatacggt |
112 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11346935 |
gaaggtaaaacgtcttcaaactgaataacggcttggaaatttgttctgccgagttcaatgaactttgcaaggaagaacacattacaaggcaatatacggt |
11346836 |
T |
 |
| Q |
113 |
gagaaatactccacaaaagaatggtgttgctgagcgaatgaatataactttttggaaagagctcgttgtatgttttcaaatgccaggctgaataggagtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11346835 |
gagaaatactccacaaaagaatggtgttgctgagcgaatgaatataactttttggaaagagctcgttgtatgttttcaaatgccgggctgaataggagtt |
11346736 |
T |
 |
| Q |
213 |
tccaagcagaggctataagcacaaaatgttat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11346735 |
tccaagcagaggctataagcacaaaatgttat |
11346704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University