View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_low_82 (Length: 240)
Name: NF18007_low_82
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_low_82 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 6633475 - 6633694
Alignment:
| Q |
5 |
tgtcgaagaaaataatgatcttttaatcatatcacaa--cattctctaaccaagtacatatatttgaacctctagtccatgtattaattccacaatctta |
102 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6633475 |
tgtccaagataataatgatcttttaatcatatcacaatacattctctaaccaagtacatatatttgaacctctagtccatgtattaattccacaatctta |
6633574 |
T |
 |
| Q |
103 |
tatatttttccaacaaaagaaaatcttatatattttgtcttcacattctctcaaattgttggattctttattgtctctgcagcacaaacatgtctatata |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6633575 |
tatatttttcca-caaaagaaaatcttatatattttgtcttcacatcctctccaattgttggattctttattgtctctgcagcacaaacatgtctatata |
6633673 |
T |
 |
| Q |
203 |
tacttcctctccccagttttc |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6633674 |
tacttcctctccccagttttc |
6633694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University