View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_low_90 (Length: 230)
Name: NF18007_low_90
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_low_90 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 43156789 - 43156985
Alignment:
| Q |
16 |
atgaaaattgtggctgtcatgtcttcattacctatgtcctctcatcacaatctctatcaccgtaagttcagatagaatttgggattggttttaccgtgtc |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
43156789 |
atgaaaattgtggttgtcatgtcttcattacctatgcactctcatcacaatctctatcaccgtaagttcagatagaatttgggattgattttactatgtc |
43156888 |
T |
|
| Q |
116 |
tgtgttctatcttttaatacaactctttttggtagtgtaattcagagcataacgacatgcgtttgtttagtatgagaaggatatttcaggagcttaa |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
43156889 |
tgtgttctatcttttaatacacctctttttggtagtgtaattcagagcataacgacatgcgcttgtttagtaggagaaggatatttgaggagcttaa |
43156985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University