View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18007_low_99 (Length: 218)
Name: NF18007_low_99
Description: NF18007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18007_low_99 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 43462461 - 43462647
Alignment:
| Q |
13 |
gagaagaatcaattttgttgtcaaacaatggttcttttaaggaatactatgagttaggagatgaacttggagaaggggaattcggaactacttcactttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43462461 |
gagaagaatcaattttgttgtcaaacaatggttcttttaaggaatactatgagttaggagatgaacttggagaaggggaatttggaactacttcactttg |
43462560 |
T |
 |
| Q |
113 |
tttggagaaatcaaccgggaaaaggtatgcatgcaaggtaatcccaaaggtgaaattgttagaagatgatgatgtagaggatgtgag |
199 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43462561 |
tttggagaaatcaaccgggaaaacgtatgcatgcaaggtaatcccaaaggtgaaattgttagaagatgatgatgtagaggatgtgag |
43462647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 25 - 199
Target Start/End: Original strand, 43453034 - 43453208
Alignment:
| Q |
25 |
ttttgttgtcaaacaatggttcttttaaggaatactatgagttaggagatgaacttggagaaggggaattcggaactacttcactttgtttggagaaatc |
124 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||| ||| ||||||||||||||||||| |||| | || ||||||||||||||||||||||||||||| |
|
|
| T |
43453034 |
ttttgttgacaaacaatggtccttttagggaattttataagttaggagatgaacttgggaaaggaaagtttggaactacttcactttgtttggagaaatc |
43453133 |
T |
 |
| Q |
125 |
aaccgggaaaaggtatgcatgcaaggtaatcccaaaggtgaaattgttagaagatgatgatgtagaggatgtgag |
199 |
Q |
| |
|
|||| |||| | || |||||||| | ||| |||||||| |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
43453134 |
aaccaggaagacatacgcatgcaaagcaataccaaaggtaaaattgtttagagagaatgatatagaggatgtgag |
43453208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University