View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18008_low_4 (Length: 293)
Name: NF18008_low_4
Description: NF18008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18008_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 105 - 277
Target Start/End: Complemental strand, 44954745 - 44954573
Alignment:
| Q |
105 |
cccaagaatcactctgaaataattaacgcgtgaaataaataaattggtgatataatattagctatgaatacgagagagtaattattgggattgaatatat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44954745 |
cccaagaatcactctgaaataattaacgcgtgaaataaataaattggtgatataatattagttatgaatacgagagagtaattattgggattgaatatat |
44954646 |
T |
|
| Q |
205 |
ggagagattttaagaaattagtgtcttgttttataagaaatgttttattacaacaagtttagtgcatgaaacc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44954645 |
ggagagattttaagaaattagtgtcttgttttataagaaatgttttattacaacaagtttagtgcatgaaacc |
44954573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 44954850 - 44954804
Alignment:
| Q |
1 |
ctctatgatgggg-atatatagtaaaatttcacacgttcttttgcag |
46 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44954850 |
ctctatgatggggtatatatagtaaaatttcacacgttcttttgcag |
44954804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University