View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18009_high_11 (Length: 250)
Name: NF18009_high_11
Description: NF18009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18009_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 220
Target Start/End: Original strand, 5112744 - 5112955
Alignment:
| Q |
9 |
attaccttgtcaagtaaggttttttattggagatgttacatgcgaaggctgacaaaaacctaagacatgtgttttttgtctttccaaagaagagggtagt |
108 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5112744 |
attaccttgtaaagtaaggttttttattggagatgttacatgcaaaggttgacaaaaacctaagacatgtgttttttgtcttttcaaagaagagggtagt |
5112843 |
T |
|
| Q |
109 |
gaaataggagctctacctctctttcttgtccttgttggtcttgcttgtaactgtggccaaagattcctaaggtaaggagattgtttgatcttttgagaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5112844 |
gaaataggagctctacctctctttcttgtccttgttggtcttgcttgtaactgtggccaaagattcctaaggtaaggagattgtttgatcttttgagaaa |
5112943 |
T |
|
| Q |
209 |
gtgagtttgatg |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5112944 |
gtgagtttgatg |
5112955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University