View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18009_low_12 (Length: 237)
Name: NF18009_low_12
Description: NF18009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18009_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 18564193 - 18563971
Alignment:
| Q |
1 |
ttattcttggaacaccagcataggagctgtcgcaatgaaccattcaccagaaaggttgcataataccttatccctcgcgttttcacaaagccgtcgaagc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
18564193 |
ttattctcggaacaccagcataggagctgtcgcaatggaccattcaccagaaaggttgcataataccctatccctcacgttttcgcaaagccgtcgaagc |
18564094 |
T |
 |
| Q |
101 |
tggagacctatgacggcaccaccgatctggacgagcacatagaacacctagataccgtcctcaattaccaccaggtgcgaggcgcagtgaagtgcaagtt |
200 |
Q |
| |
|
|||||| |||||||||||||| ||| |||||||||||||||||||||||||||| |||| |||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
18564093 |
tggagatctatgacggcaccattaatccggacgagcacatagaacacctagataccatccttaattaccatcaggtgggaggcgcggtgaagtgcaagtt |
18563994 |
T |
 |
| Q |
201 |
gtttgtgttgacactaaaaggtg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
18563993 |
gtttgtgttgacactaaaaggtg |
18563971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 223
Target Start/End: Complemental strand, 21142432 - 21142351
Alignment:
| Q |
142 |
gaacacctagataccgtcctcaattaccaccaggtgcgaggcgcagtgaagtgcaagttgtttgtgttgacactaaaaggtg |
223 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||| | ||||| | | | |||||||| ||||| |||||||||| |
|
|
| T |
21142432 |
gaacacatagataccgtcctcgattaccaccaggtgcgaggtgtggtgaaattccaattgtttgttttgacgctaaaaggtg |
21142351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University