View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18009_low_13 (Length: 216)
Name: NF18009_low_13
Description: NF18009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18009_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 12 - 153
Target Start/End: Complemental strand, 18105003 - 18104861
Alignment:
| Q |
12 |
agaaatgaagttctcacnnnnnnnaatcaagtaaataaagtaactacattctattcaattggtaacatttatttatttttagtaaaacaaacttatgtca |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18105003 |
agaaatgaagttctcactttttttaatcaagtaaataaattaattacattctattcaattggtaacatttatttatttttagtaaaacaaacttatgtca |
18104904 |
T |
 |
| Q |
112 |
tttaaattaaaacatattc-aagaatacttgtaggaatcaaat |
153 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18104903 |
tttaaattaaaacatattcaaagaatacttgtaggaatcaaat |
18104861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 14 - 115
Target Start/End: Complemental strand, 18111144 - 18111043
Alignment:
| Q |
14 |
aaatgaagttctcacnnnnnnnaatcaagtaaataaagtaactacattctattcaattggtaacatttatttatttttagtaaaacaaacttatgtcatt |
113 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18111144 |
aaatgaagttctcactttttttaatcaagcaaataaagtaattacattctattcaattgataacatttatttatttttagtaaaacaaacttatgttatt |
18111045 |
T |
 |
| Q |
114 |
ta |
115 |
Q |
| |
|
|| |
|
|
| T |
18111044 |
ta |
18111043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University