View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18009_low_9 (Length: 289)
Name: NF18009_low_9
Description: NF18009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18009_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 9002291 - 9002019
Alignment:
| Q |
1 |
cttgaatgacgacttgactagtaccctcctgctcttgtggtgaagctttttgtgaagaacacagctgctaagaaattgtttacatacaacaggcagggtc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9002291 |
cttgaatgacgacttgactattaccctcctgctcttgtggtgaagctttttgtgaagaacacagctgctaagaatttgtttacatacaacaggcagggtc |
9002192 |
T |
|
| Q |
101 |
atgctaaattaaaattacggnnnnnnnnggaaaaatacagatctcactttaggatgcaaaagatgtcttttttgtgaactataaactagatgttttaaat |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9002191 |
atgctaaattaaaattacggttttttt-ggaaaaatacagatctcactttaggatgcaaaagatgtcttttttgtgaactataaactagatgttttaaat |
9002093 |
T |
|
| Q |
201 |
cattatctatggttttataagactggtatgttatctaatgtctccttttattatgtttcctaatctcgtaattg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9002092 |
cattatctatggttttataagactggtatgttatctaatgtctttttttattatgtttcctaatctcgtaattg |
9002019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 131 - 180
Target Start/End: Original strand, 8545355 - 8545404
Alignment:
| Q |
131 |
aaaaatacagatctcactttaggatgcaaaagatgtcttttttgtgaact |
180 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
8545355 |
aaaaatacaaatctcattttaggatgcaaatgatgtcttttttgtaaact |
8545404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 180
Target Start/End: Complemental strand, 8643386 - 8643337
Alignment:
| Q |
131 |
aaaaatacagatctcactttaggatgcaaaagatgtcttttttgtgaact |
180 |
Q |
| |
|
|||||| || |||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
8643386 |
aaaaatgcatatctcattttaggatgcaaatgatgtcttttttgtaaact |
8643337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University