View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1800_high_5 (Length: 327)
Name: NF1800_high_5
Description: NF1800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1800_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 94 - 199
Target Start/End: Complemental strand, 5385329 - 5385224
Alignment:
| Q |
94 |
gagtcgatatttccttataattccacatcatcaacttttgctcctgactgggagtattttccttcctttacatctcactctcatgtcatagttgatacta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5385329 |
gagtcgatatttccttataattccacatcatcaacttttgctcctgactgggagtattttccttcctttacatctcactctcatgtcatagttgatacta |
5385230 |
T |
 |
| Q |
194 |
tcagta |
199 |
Q |
| |
|
|||||| |
|
|
| T |
5385229 |
tcagta |
5385224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 266 - 299
Target Start/End: Complemental strand, 5385157 - 5385124
Alignment:
| Q |
266 |
ttagaaatagaaagactcattcttacttaccaga |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5385157 |
ttagaaatagaaagactcattcttacttaccaga |
5385124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University