View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1800_low_21 (Length: 206)
Name: NF1800_low_21
Description: NF1800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1800_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 36 - 122
Target Start/End: Original strand, 44808214 - 44808300
Alignment:
| Q |
36 |
tgttcaggttctccatctccttgttaaagtatttcaaaagcttccttcaccagattatctgagcatttgtcagtgtcttatattctt |
122 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44808214 |
tgttcaggttctccgtctccttgttaaagtatttcaaaagcttccttcaccagattatctgagcatttgtcagtgtcttatgttctt |
44808300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 37 - 122
Target Start/End: Original strand, 2231697 - 2231782
Alignment:
| Q |
37 |
gttcaggttctccatctccttgttaaagtatttcaaaagcttccttcaccagattatctgagcatttgtcagtgtcttatattctt |
122 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2231697 |
gttcaggttctccgtctccttgttaaagtatttcaaaagcttccatcaccagattatctgagcatttgtcagtgtcttatgttctt |
2231782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 36 - 122
Target Start/End: Complemental strand, 28134946 - 28134860
Alignment:
| Q |
36 |
tgttcaggttctccatctccttgttaaagtatttcaaaagcttccttcaccagattatctgagcatttgtcagtgtcttatattctt |
122 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
28134946 |
tgttcaggttctccgcctgcttgttaaagtatttcaaaagcttccttcaccagattatctgagcatttgtcagtgtcatatgttctt |
28134860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University