View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1800_low_6 (Length: 348)
Name: NF1800_low_6
Description: NF1800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1800_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 86 - 252
Target Start/End: Complemental strand, 34200984 - 34200818
Alignment:
| Q |
86 |
ctgttgcttataatttcttttctgggtttagtcaacaatgttctaagctgttttttaggaatgttggttttgatttttcacttaattgtattcctgggag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34200984 |
ctgttgcttataatttcttttctgggtttagtcaacaatgttctaagctgttttttaggaatgttggttttgatttttcacttaattgtattcctgggag |
34200885 |
T |
|
| Q |
186 |
gaacatgcaaagacctcaacctgagtgttctatgatcccaggtggtagcttaagttgtctcagaatt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34200884 |
gaacatgcaaagacctcaacctgagtgttctatgatcccaggtggtagcttaagttgtctcagaatt |
34200818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 86 - 232
Target Start/End: Original strand, 43030745 - 43030885
Alignment:
| Q |
86 |
ctgttgcttataatttcttttctgggtttagtcaacaatgttctaagctgttttttaggaatgttggttttgatttttcacttaattgtattcctgggag |
185 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||| ||||||| | ||| || ||||||||||||||||||||| ||| || |||||||| || |
|
|
| T |
43030745 |
ctgttacttctaatttcttttctgggtttagtcaagaatgttcaaggcttttc------aatgttggttttgatttttcagataactgcattcctggtag |
43030838 |
T |
|
| Q |
186 |
gaacatgcaaagacctcaacctgagtgttctatgatcccaggtggta |
232 |
Q |
| |
|
||| ||||| | |||||||||||||||||| ||||||| ||||||| |
|
|
| T |
43030839 |
gaatatgcagaaacctcaacctgagtgttcagtgatccctggtggta |
43030885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University