View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18011_low_10 (Length: 227)
Name: NF18011_low_10
Description: NF18011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18011_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 19 - 124
Target Start/End: Original strand, 39088776 - 39088881
Alignment:
| Q |
19 |
cttatgatctcgataattggaatggtgtggatcgctttcactttaatgcaaaggtaccctttatgtttatggtatacacttctagatataggtttgcact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39088776 |
cttatgatctcgataattggaatggtgtggatcgctttcactttaatgcaaaggtaccctttatgtttatggtatacaattctagatataggtttgcact |
39088875 |
T |
 |
| Q |
119 |
tttgta |
124 |
Q |
| |
|
|||||| |
|
|
| T |
39088876 |
tttgta |
39088881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 122 - 215
Target Start/End: Original strand, 39088913 - 39089006
Alignment:
| Q |
122 |
gtaatcctggattaaaatagaagaaatgtgggtcatttttgtgtttcttttctaactttgaatatactcatactcatgtctacatgcacaggtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088913 |
gtaatcctggattaaaatagaagaaatgtgggtcattcttgtgtttcttttctaactttgaatatactcatactcatgtctacatgcacaggtt |
39089006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 44718149 - 44718100
Alignment:
| Q |
19 |
cttatgatctcgataattggaatggtgtggatcgctttcactttaatgca |
68 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44718149 |
cttatgatgttgataattggaatggtgtggatcgctttcactttaatgca |
44718100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University