View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18011_low_11 (Length: 204)
Name: NF18011_low_11
Description: NF18011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18011_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 182
Target Start/End: Original strand, 12868495 - 12868660
Alignment:
| Q |
17 |
aatatcttgaagcaacccattatctcttaacaaagcctcattaacaaaccctgaagatccaaaacctcgatgattaatcacttggtcattcacaaaacca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12868495 |
aatatcttgaagcaacccattatctcttaacaaagcctcattaacaaaccctgaagatccaaaacctcgatgattaatcacttggtcattcgcaaaacca |
12868594 |
T |
 |
| Q |
117 |
ccaaacgacgacgtgttaacataactaccactagaaccaccaacataattagaagaagggggtgta |
182 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12868595 |
ccaaacgacgacgtgttaacacaactaccaccagaaccaccaacataattagaagaagggggtgta |
12868660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University