View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18012_high_10 (Length: 243)
Name: NF18012_high_10
Description: NF18012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18012_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 45905930 - 45905717
Alignment:
| Q |
12 |
atgaacacagtaacgagtttaagggatagaaatgctaatcctctacccaacggacagcgtgttttgcccagaggtagtatgctccaaccggaccgcgacc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45905930 |
atgaacacagtaacgagtttaagggatagaaatgctaatcctctacccaacggacagcgtgttttgcccagaggtagtatgctccaaccggaccgcgacc |
45905831 |
T |
|
| Q |
112 |
acccaactcataaagctccactgatacattgtccttgtctatctcattcagaatcggagttagaatgttccatgcagctgccagctcatcgcttctcata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45905830 |
acccaactcataaagctccactgatacattgtccttgtctatctcattcagaatcggagttagaatgttccatgcagctgccagctcatcgcttctcata |
45905731 |
T |
|
| Q |
212 |
aacagatgattatc |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45905730 |
aacagatgattatc |
45905717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University