View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18012_high_4 (Length: 338)
Name: NF18012_high_4
Description: NF18012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18012_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 145 - 317
Target Start/End: Complemental strand, 9829095 - 9828923
Alignment:
| Q |
145 |
gcaaaaggtcaatgtaaaaatttataccgcaaagtaatttgaatgcaaccactagaaggagttgatgacattgtatgtcgtgttcggggaagcctacgat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9829095 |
gcaaaaggtcaatgtaaaaatttataccgcaaagtaatttgaatgcaaccactagaaggagttgatgacattgtatgtcgtgttcggggaagcctacaat |
9828996 |
T |
|
| Q |
245 |
gagaaccatttgttttgtacgcgttgcttcgcaaggtcagttcgagtacacatcttcaagtggactagcacga |
317 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9828995 |
gagaaccatttgttttgtaggcgttgcttcgcaaggtcagttcgagtatacatcttcaagtggactagcacga |
9828923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 89
Target Start/End: Complemental strand, 9829234 - 9829163
Alignment:
| Q |
19 |
acaagggtcccggatgtaaaactttttccatgcatg-gggatgttctttgataaaagctattttgcattata |
89 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9829234 |
acaagggtcccggatgtaaaactctttccatgcatgcgggatgttctttgataaaagctattttgcattata |
9829163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University