View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18012_low_12 (Length: 236)
Name: NF18012_low_12
Description: NF18012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18012_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 56 - 221
Target Start/End: Complemental strand, 29355864 - 29355699
Alignment:
| Q |
56 |
tcattggtttgtctttgaataaaatttatttacaaacacgtaaaaagcgtcccactctattctatgatttggttttcccatgatgccgtccacaactagt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29355864 |
tcattggtttgtctttgaataaaatttatttacaaacacgtaaaaagtgtcccactctattctatgacttggttttcccatgatgccgtccacaactagt |
29355765 |
T |
|
| Q |
156 |
ttgaagatatttatcatgttttccttagttgcccaaatagtgtttcacatttggtagcatgctaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29355764 |
ttgaagatatttatcatgttttccttagttgcccaaatagtttttcacatttggtagcatgctaat |
29355699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University