View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18013_high_26 (Length: 286)
Name: NF18013_high_26
Description: NF18013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18013_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 271
Target Start/End: Complemental strand, 9573440 - 9573188
Alignment:
| Q |
19 |
tcaacccgatactacactcccccactccgaacctaatcccgaacctatctccgattctcctaatcccgagtctgttacgattctcgattcaaattcttcg |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9573440 |
tcaacccgatactacacttccccactccgaacctaatcccgaacctatctccgattctcctaatcccgagtctgttacgattctcgattcaaattcttcg |
9573341 |
T |
|
| Q |
119 |
aatgaatcgaattcgagatttgaaagtgttgatgaagagaaggtggagagtggggagaagaaggatgggagattaccgatagtggtgtttttgattggac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9573340 |
aatgaatcgaattcgagatttgaaagtgttgatgaagagaaggtggagagtgtggagaagaaggatgggagattaccgatagtggtgtttttgattggac |
9573241 |
T |
|
| Q |
219 |
tatggatgagagcgaaagaaggattgaagagggcgttttcgaaattggttgat |
271 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9573240 |
tatgggtgagagcgaaagaaggattgaagagggcgttttcgaaattggttgat |
9573188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University