View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18014_low_16 (Length: 241)
Name: NF18014_low_16
Description: NF18014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18014_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 49111870 - 49111655
Alignment:
| Q |
16 |
tgaagaacagacgaggaattggagtcaccctcacgatggtaagcctaacgaagaaaaagttgctcaaatccatggttaagaatggccacaacaaccacca |
115 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49111870 |
tgaagaacagatgaggaattggagtcatcctcacgatggtaagcctaacgaagaaaaagttgctcaaatccatggttaagaatggccacaacaaccacca |
49111771 |
T |
|
| Q |
116 |
aatggctcggtttttctcaacaatgatagaatattaatacatattctc-tttaaacaataattataacattgttgatgagcttatgagaaagataatatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49111770 |
aatggctcggtttttctcaacaatgatagaatatgaatacatattctcttttaaacaataattataacattgttgatgagcttatgagaaagataatatt |
49111671 |
T |
|
| Q |
215 |
gaattgcaccattcat |
230 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49111670 |
gaattgcaccattcat |
49111655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University