View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18014_low_17 (Length: 221)
Name: NF18014_low_17
Description: NF18014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18014_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 12 - 204
Target Start/End: Original strand, 31299431 - 31299622
Alignment:
| Q |
12 |
agaaaatatcaaagaagtttatataatattttaaaataaattatgcaagatcgacataaatcacttaaatacatcatgaactatgaaaaacaaaagatta |
111 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31299431 |
agaatatatcaaagaagtttatata-tattttaaaataaattatgcaagatagacataaatcaattaaatacatcatgaactgtgaaaaacaaaagatta |
31299529 |
T |
 |
| Q |
112 |
taaatagtattcatatgtaggcttggcaaaaagagcctaatcatcttgtcccatcccgctccgtcaataacccgtataaataagggcggagtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31299530 |
taaatagtattcatatgtaggcttggcaaaaagggcctactcatcttgtcccatcccgctccgtcaataacccgtataaataagggcggagtg |
31299622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University