View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18016_low_2 (Length: 255)
Name: NF18016_low_2
Description: NF18016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18016_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 26 - 237
Target Start/End: Complemental strand, 37229878 - 37229667
Alignment:
| Q |
26 |
tagtggtgttggtagtccaatttgtgtggattctgttcttagtaaaccaatgtttgatcgtacttttggccaatatgtgagggtgctggttgatatggat |
125 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37229878 |
tagtggggttggtagtccaatttgtgtggattctgttcttagtaaaccaatgtttgatcgtacttttggccaatatgtgagggtgctggttgatatggat |
37229779 |
T |
 |
| Q |
126 |
ttaacaaaagagctgaggtataagttaatggtagagaggaaaggttacgctttccttgttgacctagaaaagtttttgtgaacattgcaaaaatgttgga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37229778 |
ttaacaaaagagctgaggtataagttaatggtagagaggaaaggttacgctttccttgttgacctagaaaagtttttgtgaacattgcaaaaatgttgga |
37229679 |
T |
 |
| Q |
226 |
caccacattgat |
237 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37229678 |
caccacattgat |
37229667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 15071861 - 15071925
Alignment:
| Q |
120 |
atggatttaacaaaagagctgaggtataagttaatggtagagaggaaaggttacgctttccttgt |
184 |
Q |
| |
|
|||||| ||||| |||||||||||||||| || |||| ||||||||||||||||||||| |||| |
|
|
| T |
15071861 |
atggatgtaacacaagagctgaggtataaattgttggtcgagaggaaaggttacgctttctttgt |
15071925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 27237641 - 27237669
Alignment:
| Q |
1 |
tgtttcatattagatccgcccatgctagt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27237641 |
tgtttcatattagatccgcccatgctagt |
27237669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 131
Target Start/End: Original strand, 17670254 - 17670320
Alignment:
| Q |
65 |
tagtaaaccaatgtttgatcgtacttttggccaatatgtgagggtgctggttgatatggatttaaca |
131 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||||||||||| || || || |||| ||| |||||| |
|
|
| T |
17670254 |
tagtaaaccaatttttgaacgaacttttggccaatatgtgagagttctagtggataaggacttaaca |
17670320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University