View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18016_low_5 (Length: 233)
Name: NF18016_low_5
Description: NF18016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18016_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 4 - 215
Target Start/End: Original strand, 50340319 - 50340530
Alignment:
| Q |
4 |
aggcactcttgccatggaaatacaaaagctggaaattgtggcttcaagttggacgtacgttttttccatcccatcacagaaataaacatagccttaaaca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50340319 |
aggcactcttgccatggaaatacaaaagctggaaattgtggcttcaagttggacgtacgttttttccatcccatcatagaaataaacatagccttaaaca |
50340418 |
T |
 |
| Q |
104 |
ctttttaaataactcagagttcaatcttctggttaaataaacttttaaaaaagttttgacctcaacaaatttgaacccagtttaaatttgtccaacttta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50340419 |
ctttttaaataactcagagttcaatcttctggttaaataaacttttaaaaaagttttgacctcaacaaatttgaacccagtttaaatttgtccaacttta |
50340518 |
T |
 |
| Q |
204 |
gtattagttctc |
215 |
Q |
| |
|
|||||||||||| |
|
|
| T |
50340519 |
gtattagttctc |
50340530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University