View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18017_high_12 (Length: 278)
Name: NF18017_high_12
Description: NF18017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18017_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 78 - 207
Target Start/End: Original strand, 45458628 - 45458757
Alignment:
| Q |
78 |
gtcaagtaactaatggttgacctgacacgccttgagagggaagaagtgtggatttcgatgtttgaacaccgacccttgcatgttattgttcttgcaacta |
177 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45458628 |
gtcaagtagctaatggttgacctgacacgccttgagaggggagaagtgtggatttcgatgtttgaacaccgacccttgcatgtcattgttcttgcaacta |
45458727 |
T |
 |
| Q |
178 |
acaattgaattgtaattacatgactcttgc |
207 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |
|
|
| T |
45458728 |
acaattgagttgaaattacatgactcttgc |
45458757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University