View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18017_low_11 (Length: 303)
Name: NF18017_low_11
Description: NF18017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18017_low_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 36 - 303
Target Start/End: Complemental strand, 37141125 - 37140858
Alignment:
| Q |
36 |
tcattatttccatcgattgcactgaagatataataacgaacaaaacaaacgaatgataatttgaatgttctttgtcctctttgatattacaactcnnnnn |
135 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37141125 |
tcattctttccatcgattgcactgaagatataataacgaacaaaacaaacgaatgataatttgaatgttctttgtcctctttgatattacaactcttttt |
37141026 |
T |
|
| Q |
136 |
nnctttatgataatttgatataatactcattgattaattatatctaaaataagaaaattgggccaaccatatatcatgaaaaatctgatcaattatagct |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37141025 |
gtctttatgataatttgatatatcactcattgattaattatatctaaaataagaaaattgggccaaccatatatcatgaaaaatctgatcaattatagct |
37140926 |
T |
|
| Q |
236 |
aagggcaataatcttggtttcacaaaagacaacatgaaagagagttgataagaaccgttattattgtt |
303 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37140925 |
aagggcaataatcttggtttcacaagagacaacatgaaagagagttgataagaaccgttattattgtt |
37140858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University