View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18017_low_18 (Length: 252)
Name: NF18017_low_18
Description: NF18017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18017_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 235
Target Start/End: Original strand, 44348932 - 44349151
Alignment:
| Q |
16 |
ataattctgcaggttgttgtctgttgttttgtgctgcagcagctagtttgtgctgctgctggttgaggggtgggtttttgtttctgccagctgctgtctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44348932 |
ataattctgcaggttgttgtctgttgttttgtgctgcagcagctagtttgtgctgctgctggttgaggggtgggtttttgtttctgctagctgctgtctt |
44349031 |
T |
 |
| Q |
116 |
ttggtttcagtgtttgtatagaaactttaggaggnnnnnnnatcaagtttggttgttggtgaggtgccgtgttttggccctattatactctttttccctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44349032 |
ttggtttcagtgtttgtatagaaactttaggaggtttttttatcaagtttggttgttggtgaggtgccgtgttttggccctattatactctttttccctt |
44349131 |
T |
 |
| Q |
216 |
gtgggttaagtactccttgt |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44349132 |
gtgggttaagtactccttgt |
44349151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University