View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18018_high_11 (Length: 429)
Name: NF18018_high_11
Description: NF18018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18018_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 11 - 376
Target Start/End: Original strand, 49862014 - 49862370
Alignment:
| Q |
11 |
aagaagtgacaattgatatgtgtgaaccggaattggttttgggttcgagttctggtgatgaaatgaaccagtctgtatcggaattttcttcttcttgttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49862014 |
aagaagtgacaattgatatgtgtgaaccggaattggttttgggttcgagttctggtgaagaaatgaaccggtctgtatcggaattttcttcttcttgttc |
49862113 |
T |
|
| Q |
111 |
ttcctcatgttctgatgagaagcaatcttcattggttgacattaccgttgagattccgagaaggagtgaatccgattgcaagagttttgctgtgggagag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862114 |
ttcctcatgttctgatgagaagcaatcttcatcggttgacattaccgttgagattccgagaaggagtgaatccgattgcaagagttttgctgtgggagag |
49862213 |
T |
|
| Q |
211 |
tcgagttgtgattcaccatcatcgtttcggtcaccaatgagtcgtgttttgtcgttcacgagaatccttagcagagagaggaaaccaagcatttctccgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862214 |
tcgagttgtgattcaccatcatcgtttcggtcaccaatgagtcgtgttttgtcgttcacgagaatccttagcagagagaggaaaccaagcatttctccgt |
49862313 |
T |
|
| Q |
311 |
cgttggattgtgccgcagatgcagaatgaggtgaaagggaggagactcagtgagttgattgatgac |
376 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49862314 |
cgttggattg---------tgcagaacgaggtgaaagggaggagactcggtgagttgattgatgac |
49862370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University