View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18018_high_14 (Length: 366)
Name: NF18018_high_14
Description: NF18018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18018_high_14 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-137; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 72 - 351
Target Start/End: Original strand, 14459036 - 14459315
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaaataaacactacaaaggaatgataaagaacgtggcataacgtagatatccattctttnnnnnnnntg |
171 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
14459036 |
atcccgtgcttggcacgaggcgtaacactagtaaataaacactacaaaggaatgataaagaacgtggcataacatagatatccattctttaaaaaaaatg |
14459135 |
T |
 |
| Q |
172 |
tagatatccattgtgcgttaggattattagagattaattgcttcggttttagtagttttaaaccaagtctcataaaataacttgtaatgcaagtcatcta |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14459136 |
tagatatccattgtgcgttaggattattagagattaattgcttcggttttagtagttttaaaccaagtctcataaaataacttgtaatgcaagtcatcta |
14459235 |
T |
 |
| Q |
272 |
gtctagtgcattctaccttgttgcttgcctataaataagcatcttttgtattttagaagattgaatgaaattcatacttt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14459236 |
gtctagtgcattctaccttgttgcttgcctataaataagcatcttttgtattttagaagattgaatgaaattcatacttt |
14459315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 105
Target Start/End: Original strand, 16485771 - 16485804
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaa |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
16485771 |
atcccgtgcttggcacggggcgttacactagtaa |
16485804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 105
Target Start/End: Complemental strand, 36786650 - 36786617
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaa |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
36786650 |
atcccgtgcttggcacggggcgttacactagtaa |
36786617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 16483326 - 16483358
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
16483326 |
atcccgtgcttggcacggggcgttacactagta |
16483358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 25340123 - 25340155
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
25340123 |
atcccgtgcttggcacggggcgttacactagta |
25340155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 28907575 - 28907543
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
28907575 |
atcccgtgcttggcacggggcgttacactagta |
28907543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 28943970 - 28943938
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
28943970 |
atcccgtgcttggcacggggcgttacactagta |
28943938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 39560415 - 39560383
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
39560415 |
atcccgtgcttggcacggggcgttacactagta |
39560383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 40835867 - 40835899
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
40835867 |
atcccgtgcttggcacggggcgttacactagta |
40835899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 188 - 342
Target Start/End: Complemental strand, 31311641 - 31311491
Alignment:
| Q |
188 |
gttaggattattagagattaattgcttcggttttagtagttttaaaccaagtctcataaaataacttgtaatgcaagtcatctagtctagtgcattctac |
287 |
Q |
| |
|
|||||||| ||||||| |||||||| || | ||||||||||||| || |||||| ||| ||||||||||||||| ||||||||| ||| |||||| |
|
|
| T |
31311641 |
gttaggataattagaggttaattgcatcagctttagtagttttagactaagtcttgtaagataacttgtaatgca----atctagtcttgtg-attctat |
31311547 |
T |
 |
| Q |
288 |
cttgttgc-ttgcctataaataagcatcttttgtattttagaagattgaatgaaat |
342 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
31311546 |
tttgttgctttgcctataaataagcatcccttgtagtttagaagaatgaatgaaat |
31311491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 109
Target Start/End: Original strand, 42438834 - 42438871
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaaataa |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
42438834 |
atcccgtgcttggcacggggcgttacactagtatataa |
42438871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 2844724 - 2844756
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
2844724 |
atcccgtgcttggcacggggcgttacactagta |
2844756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 16662022 - 16661990
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
16662022 |
atcccgtgcttggcacggggcgttacactagta |
16661990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 38297059 - 38297091
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
38297059 |
atcccgtgcttggcacggggcgttacactagta |
38297091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 45542244 - 45542276
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
45542244 |
atcccgtgcttggcacggggcgttacactagta |
45542276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 108
Target Start/End: Complemental strand, 10118779 - 10118743
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaaata |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10118779 |
atcccgtgcttggcacggggcgttacactagtaaata |
10118743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 22403195 - 22403227
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
22403195 |
atcccgtgcttggcacggggcgttacactagta |
22403227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 106
Target Start/End: Original strand, 42054455 - 42054489
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaaa |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42054455 |
atcccgtgcttggcacggggcgttacactagtaaa |
42054489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 105
Target Start/End: Original strand, 6617855 - 6617888
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaa |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
6617855 |
atcccgtgcttggcacggggcgttacactagtaa |
6617888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 18781594 - 18781562
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
18781594 |
atcccgtgcttggcacggggcgttacactagta |
18781562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 105
Target Start/End: Original strand, 6421734 - 6421767
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaa |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
6421734 |
atcccgtgcttggcacggggcgttacactagtaa |
6421767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 105
Target Start/End: Complemental strand, 39617154 - 39617121
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagtaa |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
39617154 |
atcccgtgcttggcacggggcgttacactagtaa |
39617121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 12498020 - 12497988
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
12498020 |
atcccgtgcttggcacggggcgttacactagta |
12497988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 13276718 - 13276686
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
13276718 |
atcccgtgcttggcacggggcgttacactagta |
13276686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 193906 - 193874
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
193906 |
atcccgtgcttggcacggggcgttacactagta |
193874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 4268597 - 4268565
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
4268597 |
atcccgtgcttggcacggggcgttacactagta |
4268565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 18898149 - 18898117
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
18898149 |
atcccgtgcttggcacggggcgttacactagta |
18898117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 4946342 - 4946374
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
4946342 |
atcccgtgcttggcacggggcgttacactagta |
4946374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 9765504 - 9765472
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
9765504 |
atcccgtgcttggcacggggcgttacactagta |
9765472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 39118958 - 39118926
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
39118958 |
atcccgtgcttggcacggggcgttacactagta |
39118926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 104
Target Start/End: Complemental strand, 42839946 - 42839914
Alignment:
| Q |
72 |
atcccgtgcttggcacggggcgtaacactagta |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
42839946 |
atcccgtgcttggcacggggcgttacactagta |
42839914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University